AP Genetics Review

Review Sessions: 3,5 or 7 by appointment;

Multiple Choice

Identify the letter of the choice that best completes the statement or answers the question. Answers will be posted by Thursday on the wall outside the classroom.

____ 1. Sex-Linked Traits

a.	are carried on an autosome but expressed only in males	d.	are always inherited from the mother in mammals and fruit flies
b.	are coded for by genes located on a sex chromosome	e.	depend on whether the gene was inherited from the mother or the father
c.	are found in only one or the other sex, depending on the sex-determination system of the species

____ 2. The genetic event that results in Turner syndrome (XO) is probably

a.	nondisjunction	d.	monoploidy
b.	deletion	e.	independent assortment
c.	parental imprinting

____ 3. The 1:1:1:1 ratio of offspring from a dihybrid test-cross indicates that

a.	the genes are linked	d.	the genes are 25 map units apart
b.	the dominant organism was homozygous	e.	the genes are not linked
c.	crossing over has occurred

____ 4. A female tortoise-shell cat is heterozygous for the gene that determines black or orange coat color, which is located in the X chromosome. A male tortoise-shell cat

a.	is hemizygous at this loci	d.	must have three alleles for coat color, one from his father and two from his mother
b.	must have had a tortoise-shell mother	e.	would be hermaphroditic
c.	must have resulted from a nondisjunction and has an extra Barr body in his cells

____ 5. A son inherits color blindness from his

a.	mother	d.	father only if he is color-blind
b.	father	e.	mother only if she is not color-blind
c.	mother only if she is color-blind

____ 6. Genomic imprinting

a.	explains cases in which the gender of the parent from whom an allele is inherited affects the expression of that allele	d.	may explain the transmission of Duchenne muscular dystrophy
b.	is greatest in females because of the largest maternal contribution of cytoplasm	e.	involves both a and b
c.	is more likely to occur in offspring of older mothers

____ 7. A cross of wild-type red-eyed female Drosophilia with a violet-eyed male produces all red-eyed offspring. If the gene is sex-linked, what should the reciprocal cross (violet-eyed female by red-eyed male) produce? (Assume that the red allele is dominant to the violet allele.)

a.	all violet-eyed flies	d.	red-eyed females and violet-eyed males
b.	3 red-eyed flies to 1 violet-eyed	e.	all red-eyed flies
c.	a 1:1 ratio of red and violet eyes in both males and females

____ 8. A couple who are both carriers for the gene for cystic fibrosis have two children who have cystic fibrosis. What is the probability that their next child will have cystic fibrosis?

a.	0%	d.	75%
b.	25%	e.	100%
c.	50%

____ 9. What is a genetic cross called between an individual of unknown genotype and a homozygous recessive?

a.	a self-cross	d.	an F1 cross
b.	a testcross	e.	a dihybrid cross
c.	a hybrid cross

____ 10. In crossing a homozygous recessive with a heterozygote, what is the chance of getting an offspring with the homozygous recessive phenotype?

a.	0%	d.	75%
b.	25%	e.	100%
c.	50%

____ 11. In snapdragons, heterozygotes have pink flowers, whereas the two homozygotes have red flowers or white flowers. When plants with red flowers are crossed with plants with white flowers, what proportion of the offspring will have pink flowers?

a.	05	d.	75%
b.	25%	e.	100%
c.	50%

____ 12. Black fur in mice (B) is dominant to brown fur (b). short tails (T) is dominant to long tails (t). What proportion of the progeny of the cross BbTt x BBtt will have black fur and long tails?

a.	1/16	d.	8/16
b.	3/16	e.	9/16
c.	6/16

____ 13. Feather color in budgies is determined by two different genes that affect the pigmentation of the outer feather and its core. The inheritance of color in budgies is an example of what genetic phenomenon?

a.	pleiotropy	d.	dominance
b.	penetrance	e.	epistasis
c.	polygenic inheritance

____ 14. What was the most significant conclusion that Gregor Mendel drew from his research?

a.	there is considerable genetic variation in garden peas	d.	genes are composed of DNA
b.	traits are inherited in discrete units, one from each parent	e.	an organism that is homozygous for many recessive traits is at a disadvantage
c.	dominant genes occur more frequently than recessive ones

____ 15. A woman who belongs to blood group A and Rh positive has a daughter who is O positive and a son who is B negative. Rh positive is dominant over Rh negative. Which is a possible phenotype for the father?

a.	A negative	d.	A positive
b.	O negative	e.	O positive
c.	B positive

____ 16. The fact that all seven of the garden pea traits studied by Mendel obeyed the principle of independent assortment means that the

a.	haploid number of garden peas is 7	d.	seven pairs of alleles determining these traits behave as if they are on different chromosomes
b.	diploid number of garden peas is 7	e.	formation of gametes in plants is by mitosis only
c.	seven pairs of alleles determining these traits are on the same pair of homologous chromosomes

____ 17. A 9:3:3:1 phenotypic ratio is characteristic of the

a.	F1 generation of a monohybrid cross	d.	F2 generation of a dihybrid cross
b.	F2 generation of a monohybrid cross	e.	F2 generation of a trihybrid cross
c.	F1 generation of a dihybrid cross

____ 18. A 1:2:1 phenotypic ration in the F2 generation of a monohybrid cross is a sign of

a.	complete dominance	d.	polygenic inheritance
b.	multiple alleles	e.	pleiotropy
c.	incomplete dominance

____ 19. How many unique gametes could be produced through independent assortment by an individual with the genotype AaBbCCDdEE?

a.	4	d.	32
b.	8	e.	1/64
c.	16

____ 20. The effects of this recessive single gene can be completely overcome by regulating the diet of the affected individual.

a.	Huntington’s disease	d.	hemophilia
b.	Tay-Sachs disease	e.	sickle-cell disease
c.	phenylketonuria

____ 21. This is caused by a dominant single gene defect and generally does not appear until the individual is 30-40 years of age.

a.	Huntington’s disease	d.	hemophilia
b.	Tay-Sachs disease	e.	sickle-cell disease
c.	phenylketonuria

____ 22. Individuals with this disorder are unable to metabolize gangliosides, which affects proper brain development. Affected individuals die in early infancy.

a.	Huntington’s disease	d.	hemophilia
b.	Tay-Sachs disease	e.	sickle-cell disease
c.	phenylketonuria

____ 23. Substitution of the wrong amino acid in the hemoglobin protein results in this disorder.

a.	Huntington’s disease	d.	hemophilia
b.	Tay-Sach’s disease	e.	sickle-cell disease
c.	phenylketonuria

____ 24. Fragile X syndrome is more common in males than in females. One explanation for this is

a.	genomic imprinting by the mother	d.	only A and C are correct
b.	sex-linked inheritance	e.	a, B, and C are correct
c.	uniparental disomy

____ 25. What do all human males inherit from their mother?

a.	mitochondrial DNA	d.	only A and B are correct
b.	X chromosome	e.	A, B and C are correct
c.	male-pattern baldness trait

____ 26. What does independent assortment refer to?

a.	the separation of alleles in anaphase I	d.	the random arrangement of gene loci on a chromosome
b.	the random arrangement of chromosomal tetrads at metaphase I	e.	the fact that any pair of chromatids in a tetrad can cross over
c.	the separation of chromatids at anaphase II

____ 27. People who have red hair usually have freckles. this can best be explained by

a.	linkage	d.	sex-influenced inheritance
b.	reciprocal translocation	e.	nondisjunction
c.	independent assortment

____ 28. If cytosine makes up 22% of the nucleotides in a sample of DNA from an organism, then adenine would make up what percentage of bases?

a.	22	d.	56
b.	44	e.	It cannot be determined
c.	28

____ 29. The problem of replicating the lagging strand, that is adding bases in the 3’ to 5’ direction, is solved by DNA through the use of

a.	base pairing	d.	Okazaki fragments
b.	replication forks	e.	topoisomerases
c.	the unwinding enzyme, helicase

____ 30. All of the following elements are present in DNA except

a.	oxygen	d.	sulfur
b.	nitrogen	e.	phosphorus
c.	carbon

____ 31. All of the following were determined directly from X-ray diffraction photographs of crystallized DNA except

a.	the diameter of the double helix	d.	the linear distance required for one full turn of the double helix
b.	the helical shape of DNA	e.	the width of the helix
c.	the specificity of base pairing

____ 32. Which enzyme catalyzes the elongation of a DNA strand in the 5’ to 3’ direction?

a.	primase	d.	topoisomerase
b.	DNA ligase	e.	helicase
c.	DNA polymerase

____ 33. What is the primer that is required to initiate the synthesis of a new DNA strand?

a.	RNA	d.	ligase
b.	DNA	e.	primase
c.	protein

____ 34. In analysis of the nucleotide composition of DNA, which of the following are (is) true?

a.	A=C	d.	A+T=G+C
b.	A=G and C=T	e.	Both B and C are true
c.	A+C=G+T

____ 35. For a couple of decades, the prevailing opinion was that proteins were the “genes” and DNA was a “string” that held them together. The reason for this belief was

a.	all of the below are correct	d.	proteins are made of 20 amino acids and DNA is made of four nucleotides
b.	proteins take a greater variety of three-dimensional forms	e.	proteins can vary in their polarity and charge; DNA cannot
c.	proteins have four different levels of structure; DNA has only two

____ 36. Where is the attachment site for RNA polymerase?

a.	structural gene region	d.	operator region
b.	initiation region	e.	regulator region
c.	promoter region

____ 37. What is an anticodon part of?

a.	DNA	d.	ribosome
b.	tRNA	e.	activating enzyme
c.	mRNA

____ 38. A particular triplet of bases in the coding sequence of DNA is AGT. The corresponding codon for the mRNA transcribed is

a.	AGT	d.	AGU
b.	UCA	e.	either UCA or TCA, depending on wobble in the first base
c.	TCA

____ 39. A particular eukaryotic protein is 300 amino acids long. Which of the following could be the number of nucleotides in the DNA that codes for this protein?

a.	3	d.	900
b.	100	e.	903
c.	300

____ 40. What are the coding segments of a stretch of eukaryotic DNA called?

a.	introns	d.	replicons
b.	exons	e.	transposons
c.	codons

____ 41. From the following list, which is the first event in translation in eukaryotes?

a.	elongation of the polypeptide	d.	covalent bonding between the first two amino acids
b.	base pairing of activated methionine-tRNA to AUG of the messenger	e.	Both B and D occur simultaneously
c.	binding of the larger ribosomal subunit to smaller ribosome subunits

____ 42. Which of these statements represents a common misconception regarding point mutations?

a.	they involve changes in one base pair	d.	they can lead to the shortening of the mutated polypeptide
b.	they can cause drastic changes in polypeptide structure	e.	they could result in a frameshift mutation
c.	they always produce a change in the amino acid sequence of a protein

____ 43. The following DNA sequence shows a “gene” encoding a small peptide. The three “stop” codons are UAA, UAG, and UGA. The promoter is in parentheses. Find the start codon and then count how many amino acids are coded for until a stop codon is reached. (Hint: which strand is the coding strand?)

5’(ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG3’

3’(TACTGCATATT) ACTGGCATGTACTCAT TATGTAT TTAGTC5’

a.	3	d.	6
b.	4	e.	7
c.	5

____ 44. What is the sequence of a peptide based on the mRNA sequence 5’UUUUCUUAUUGUCUU3’?

a.	LEU-CYS-TYR-SER-PHE	d.	LEU-PRO-ASP-LYS-GLY
b.	CYC-PHE-TYR-CYS-LEU	e.	PHE-SER-TYR-CYS-LEU
c.	PHE-LEU-ILE-MET-VAL

____ 45. All of the following are found in prokaryotic messenger RNA except

a.	the AUG codon	d.	uracil
b.	the UGA codon	e.	cytosine
c.	introns

____ 46. When an area of a chromatid is exchanged with the matching area on a chromatid of its homologous chromosome, _____ occurs.

a.	crossing over	c.	hybridization
b.	mutagenesis	d.	fertilization

____ 47. Mendel's law of segregation states that during meiosis, the factors that control each trait separate, and only _____ from each pair is/are passed to the offspring.

a.	one factor	c.	two factors
b.	the dominant trait	d.	the recessive trait

____ 48. The law of independent assortment states that the inheritance of alleles for one trait is not affected by the inheritance of alleles for a different trait if the genes for the traits are on _____.

a.	separate chromosomes	c.	the same chromosome
b.	homologous chromosomes	d.	homozygous chromosomes

____ 49. A female guinea pig homozygous dominant for black fur color is mated with a male homozygous for white fur color. In a litter of eight offspring, there would probably be _____.

a.	8 black guinea pigs
b.	4 black and 4 white guinea pigs
c.	2 black, 4 gray, and 2 white guinea pigs
d.	8 white guinea pigs

____ 50. The numbers in Figure 10-1 represent the chromosome number found in each of the dog cells shown. The processes that are occurring at A and B are _____.

Figure 10-1

a.	mitosis and fertilization	c.	mitosis and pollination
b.	meiosis and fertilization	d.	meiosis and pollination

____ 51. Genes located on homologous chromosomes may have alternate forms that control different forms of a trait. These alternate forms of a gene are called _____.

a.	alleles	c.	phenotypes
b.	centromeres	d.	gametes

____ 52. A white mouse whose parents are both white produces only brown offspring when mated with a brown mouse. The white mouse is most probably _____.

a.	homozygous recessive	c.	homozygous dominant
b.	heterozygous	d.	haploid

____ 53. In chickens, rose comb (R) is dominant to single comb (r). A homozygous rose-combed rooster is mated with a single-combed hen. All of the chicks in the F₁ generation were kept together as a group for several years. They were allowed to mate only within their own group. What is the expected phenotype of the F₂ chicks?

a.	100% rose comb	c.	100% single comb
b.	75% rose comb and 25% single comb	d.	50% rose comb and 50% single comb

____ 54. In mink, brown fur color is dominant to silver-blue fur color. If a homozygous brown mink is mated with a silver-blue mink and 8 offspring are produced, how many would be expected to be silver-blue?

a.	0	c.	6
b.	3	d.	8

____ 55. The diagram in Figure 10-2 shows a diploid cell with two homologous pairs of chromosomes. Due to independent assortment, the possible allelic combinations that could be found in gametes produced by the meiotic division of this cell are _____.

Figure 10-2

a.	Bb, Dd, BB, and DD	c.	BbDd and BDbd
b.	BD, bD, Bd, and bd	d.	Bd and bD only

____ 56. Using Figure 10-3, which process would result in the formation of chromosome C from chromosomes A and B?

Figure 10-3

a.	asexual reproduction	c.	crossing over
b.	independent assortment	d.	segregation

____ 57. Watson and Crick were the first to suggest that DNA is _____.

a.	a short molecule	c.	a protein molecule
b.	the shape of a double helix	d.	the genetic material

____ 58. The chromosome abnormality that occurs when part of one chromosome breaks off and is added to a different chromosome is _____.

a.	deletion	c.	translocation
b.	nondisjunction	d.	inversion

____ 59. The process by which a DNA molecule is copied is called _____.

a.	binary fission	c.	replication
b.	mitosis	d.	translation

____ 60. Messenger RNA is formed in the process of _____.

a.	transcription	c.	replication
b.	translation	d.	mutation

Figure 11-1

____ 61. In which part of the cell does this process shown in Figure 11-1 take place?

a.	in the nucleus	c.	at the ribosomes
b.	in food vacuoles	d.	on the chromosome

____ 62. Which of the structures in Figure 11-1 are composed of RNA?

a.	II and IV	c.	I and V
b.	III and IV	d.	III and V

____ 63. Structure III in Figure 11-1 represents a(n) _____.

a.	gene	c.	codon
b.	amino acid	d.	DNA molecule

____ 64. The process illustrated in Figure 11-1 is called _____.

a.	translation	c.	monoploidy
b.	replication	d.	transcription

____ 65. A DNA segment is changed from-AATTAG- to -AAATAG-. This is a ____.

a.	frameshift mutation	c.	inversion
b.	point mutation	d.	deletion

____ 66. A DNA segment is changed from -AATTAGAAATAG- to -ATTAGAAATAG-. This is a ____.

a.	frameshift mutation	c.	inversion
b.	point mutation	d.	translation

____ 67. A trait controlled by four alleles is said to have _____.

a.	homologous alleles	c.	hybridization
b.	autosomes	d.	multiple alleles

____ 68. If a female fruit fly heterozygous for red eyes (X^RX^r) crossed with a white-eyed male (X^rY), what percent of their offspring would have white eyes?

a.	0%	c.	50%
b.	25%	d.	75%

____ 69. When roan cattle are mated, 25% of the offspring are red, 50% are roan, and 25% are white. Upon examination, it can be seen that the coat of a roan cow consists of both red and white hairs. This trait is one controlled by _____.

a.	multiple alleles	c.	sex-linked genes
b.	codominant alleles	d.	polygenic inheritance

____ 70. A cross between a white rooster and a black hen results in 100% blue Andalusian offspring. When two of these blue offspring are mated, the probable phenotypic ratio seen in their offspring would be _____.

a.	100% blue	c.	75% blue, 25% white
b.	75% black, 25% white	d.	25% black, 50% blue, 25% white

____ 71. Because the gene for red-green color blindness is located on the X chromosome, it is normally not possible for a _____.

a.	carrier mother to pass the gene on to her daughter
b.	carrier mother to pass the gene on to her son
c.	color blind father to pass the gene on to his daughter
d.	color blind father to pass the gene on to his son

____ 72. Which of the bar graphs shown below represents what the phenotypic frequencies might be for polygenic inheritance?

Figure 12-3

____ 73. What is the probable mode of inheritance for the normal trait in Figure 12-3?

a.	simple dominant	c.	sex linkage
b.	polygenic	d.	multiple alleles

____ 74. Eye color in humans is the result of _____ inheritance.

a.	multiple allelic	c.	sex-linked
b.	polygenic	d.	simple dominant

____ 75. Royal hemophilia is the result of _____ inheritance.

a.	multiple allelic	c.	sex-linked
b.	polygenic	d.	simple dominant

____ 76. The blood types A, B, AB, and O are the result of _____ inheritance.

a.	multiple allelic	c.	sex-linked
b.	polygenic	d.	simple dominant

____ 77. Two healthy parents produce a child with the genetic disorder of cystic fibrosis, which is the result of a recessive gene. What would be the best explanation for this inheritance?

a.	This is not the result of a genetic disorder.
b.	Both parents carried the recessive gene for cystic fibrosis.
c.	Cystic fibrosis is a chromosomal mutation that occurred during development and is not related to the parental genotypes.
d.	Cystic fibrosis is caused by a mutation in the 21st pair of chromosomes.

____ 78. According to Figure 12-5, what is the chance that individual A will be afflicted with Huntington's?

Figure 12-5

a.	25%	c.	75%
b.	50%	d.	100%

____ 79. The reason a fetus afflicted with PKU is not affected until after birth is that _____.

a.	the child is not bruised or cut during development and therefore does not require a blood-clotting factor
b.	prior to birth, the mother's enzyme level prevents accumulation of the dangerous chemical
c.	the missing chromosome is compensated for by the mother prior to delivery
d.	because the fetus does not breathe, the accumulation of mucus in the lungs is not dangerous

____ 80. Sickle-cell anemia is a genetic disease common to human populations from Africa and the Mediterranean coast. The incidence is greater in these regions than elsewhere because the heterozygous state provides protection against malaria. Individuals afflicted with sickle-cell anemia _____.

a.	are two times more likely to be males than to be females
b.	will not exhibit the symptoms of the disease until around age 40
c.	suffer tissue damage resulting from oxygen deprivation
d.	lack an enzyme that breaks down a lipid produced in the central nervous system

AP Genetics Review

Answer Section

MULTIPLE CHOICE

1. ANS: B

2. ANS: A

3. ANS: A

4. ANS: C

5. ANS: A

6. ANS: A

7. ANS: D

8. ANS: B

9. ANS: B

10. ANS: C

11. ANS: E

12. ANS: D

13. ANS: E

14. ANS: B

15. ANS: C

16. ANS: D

17. ANS: D

18. ANS: C

19. ANS: B

20. ANS: C

21. ANS: A

22. ANS: B

23. ANS: E

24. ANS: A

25. ANS: D

26. ANS: A

27. ANS: A

28. ANS: C

29. ANS: D

30. ANS: D

31. ANS: C

32. ANS: C

33. ANS: A

34. ANS: C

35. ANS: A

36. ANS: C

37. ANS: B

38. ANS: B

39. ANS: E

40. ANS: B

41. ANS: B

42. ANS: C

43. ANS: B

44. ANS: E

45. ANS: C

46. ANS: A DIF: B OBJ: 10-4

47. ANS: A DIF: B OBJ: 10-5

48. ANS: A DIF: B OBJ: 10-1

49. ANS: A DIF: B OBJ: 10-2

50. ANS: B DIF: B OBJ: 10-3

51. ANS: A DIF: B OBJ: 10-1

52. ANS: A DIF: B OBJ: 10-2

53. ANS: B DIF: B OBJ: 10-2

54. ANS: A DIF: B OBJ: 10-2

55. ANS: B DIF: B OBJ: 10-5

56. ANS: C DIF: B OBJ: 10-3

57. ANS: B DIF: B OBJ: 11-1

58. ANS: C DIF: B OBJ: 11-5

59. ANS: C DIF: B OBJ: 11-2

60. ANS: A DIF: B OBJ: 11-4

61. ANS: C DIF: B OBJ: 11-4

62. ANS: A DIF: B OBJ: 11-4

63. ANS: B DIF: B OBJ: 11-4

64. ANS: A DIF: B OBJ: 11-4

65. ANS: B DIF: B OBJ: 11-5

66. ANS: A DIF: A OBJ: 11-5

67. ANS: D DIF: B OBJ: 12-5

68. ANS: C DIF: A OBJ: 12-6

69. ANS: B DIF: A OBJ: 12-4

70. ANS: D DIF: A OBJ: 12-4

71. ANS: D DIF: A OBJ: 12-6

72. ANS: A DIF: A OBJ: 12-8

73. ANS: C DIF: A OBJ: 12-1

74. ANS: B DIF: B OBJ: 12-8

75. ANS: C DIF: B OBJ: 12-8

76. ANS: A DIF: B OBJ: 12-8

77. ANS: B DIF: B OBJ: 12-2

78. ANS: B DIF: A OBJ: 12-1

79. ANS: B DIF: B OBJ: 12-2

80. ANS: C DIF: B OBJ: 12-8